Chemguide: Support for CIE A level Chemistry

This statement is about the use of electrophoresis in DNA fingerprinting (DNA profiling).

Before you go on, you should find and read the statement in your copy of the syllabus.

DNA fingerprinting

The finished product

Most people will have seen pictures like the one on the right showing a finished DNA fingerprint (or profile). This shows a comparison of the DNA of two suspects A and B with DNA in evidence (E) from a crime scene.

It is fairly easy to see that A's DNA matches the evidence.

This page is designed to give you enough idea of how a DNA profile like this is produced to satisfy the needs of the CIE syllabus.

The problem is that there are old and new methods of doing this, and these differ quite a lot in the details. Modern techniques don't actually produce pictures like this either.

I am going to concentrate on the older method, because it is a bit easier to understand, and also because it matches the sort of material that CIE are producing.

Background information

You will know that the structures of all the proteins in the body come from genetic code carried by DNA. In humans, this DNA is found in 46 chromosomes, arranged in 23 pairs. One member of each pair of chromosomes comes from the father, and the other from the mother.

Each chromosome has a whole lot of genes strung out along it, and each gene is responsible for the code to make a particular protein.

But in between the genes are lengths of DNA which don't code for proteins, and in these lengths you can find repeated patterns of DNA bases.

So, for example, you might get short sequences (like this GATA sequence) repeated 5 times:

GATAGATAGATAGATAGATA

. . . or repeated 10 times:

GATAGATAGATAGATAGATAGATAGATAGATAGATAGATA

. . . or however many times.

The number of repeats will be different from person to person.

All the chromosomes will contain repeated sequences of variable lengths. Some sequences are short (as the GATA sequence above); some can be up to 80 "letters" long. And each sequence can be repeated a number of times varying from person to person.

Using teaching material from the Dolan DNA Learning Center

Repeating sequences in DNA

I came to this topic as a non-biologist knowing nothing whatsoever about how genetic fingerprinting works. When I was researching it, I found this DNA Learning Center material to be by far the most helpful, and least confusing, of all the sites I visited.

So I want to guide you through some of their material. You will need to go to this DNA Learning Center page. I suggest that you open this in a new browser tab (or at least in a new browser window), so that you can flip easily back and forward to this page.

Start by choosing the Human Identification module by clicking the box in the bottom left-hand corner.

Having read that page, click on the word "profiling" in the top line of the page to the right of the words "Human Identification".

Read that page, and then click on the left-hand one of the three big circles above the text, and then, finally, click on the A button to lead you into a simple sequence of animations. Follow that through to the end.

If you aren't a biologist, don't worry too much about any long words you come across. CIE will probably expect you to recognise the terms VNTR and STR, though.

VNTR are repeated sequences of from about 9 - 90 "letters". STR are repeated sequences of from 2 - 8 "letters". Just recognise that the S in STR stands for short.

When you have finished this sequence, you could, if you want to, watch the two short video clips by clicking on the two V buttons just underneath the A button you pressed before.

Cutting the DNA up and producing a DNA fingerprint

This is the core of the DNA fingerprinting process.

If you already have the DNA Learning Centre material in a separate browser tab or window, you can go back to this and continue from where you left off. You need to click on the second of the three big circles which explains the first DNA fingerprints.

Now go into the animation sequence by clicking on the A button. Work through this to the end.

More modern techniques

You could find out about these from the DNA Learning Center by clicking on the third of the big circles. However, I don't think that this is necessarily a good idea, because it leads you to methods which are quite unlike those asked about by CIE - and you risk getting confused.

There is, though, one point which CIE do want you to know about, and which came up as a small part of a major question about DNA fingerprinting in June 2011.

The technique you have looked at up to now needs a reasonable amount of DNA to work with. More modern techniques will work with very, very tiny amounts. They do this by multiplying up the DNA using the enzyme DNA polymerase.

According to the Chemistry Applications Support Booklet, this is done after the DNA has been chopped up using restriction enzymes. Huge numbers of copies of a particular segment in the resulting mixture which contains the repeating sequence you are interested in can then be produced. This is known as a Polymerisation Chain Reaction (PCR).

Summarising what you are likely to need for CIE exam purposes

Up to June 2013, CIE had asked about this several times, but without any real detail. What follows would cope with the process of producing the fingerprint.

Extract the DNA

DNA can be obtained from blood, hair, skin and semen, for example.

Chop the DNA into short segments

A number of different restriction enzymes can cut the DNA into smaller segments. These enzymes can be chosen to target segments containing particular repeating sequences of bases.

Multiply up the number of particular segments if your DNA sample is very small

You can use the polymerisation chain reaction (PCR).

Place the samples in troughs on agarose gel

The agarose gel is the support medium for electrophoresis.

Carry out the electrophoresis

Because of the phosphate groups in DNA, the segments that the DNA splits into will carry negative charges, and so will all move towards the positive electrode. Segments with a small number of repeats will travel faster, and therefore further, than those longer ones with more repeats.

Make the fingerprint visible

This is done by transferring the fingerprint on the gel to a more stable nylon membrane using a technique called "Southern blotting" (named after the inventor of the technique). This is then treated with radioactively labelled probes.

These are short lengths of DNA, radioactively labelled with phosphorus-32 atoms. These are designed to bind with the repeating sequences in the DNA fragments.

If a sheet of photographic (or X-ray) film is placed over the membrane, radiation from the radioactive phosphorus fogs the film. That produces the effect that you will have seen in the graphic at the top of this page.

Some uses of DNA fingerprinting

Forensic science

We have already mentioned this at the top of the page. Notice that DNA matching in forensic science doesn't only help to convict guilty people, but it also helps to eliminate innocent people as possible suspects.

Paternity testing

You should remember from the DNA Learning Center material that you have 23 pairs of chromosomes. One of each pair comes from your mother, and one from your father.

It is possible to get restriction enzymes which are so selective that they will only cut out a particular sequence of repetitions at one particular site on one particular pair of chromosomes.

If you just used that one enzyme, you would get a single band in the fingerprint which was due to your mother and a single band which was due to your father. If you can do this across a number of different chromosome pairs, then half of the bands would come from your mother and half from your father.

You will find a short neat paternity testing animation from Sumanas Inc if you follow this link. Use the Continue button to advance through the animation, unless you want to go backwards, in which case use the back arrow.

This animation would give you enough understanding to answer a 2 mark part of the June 2011 question.

DNA and archeology

The same June 2011 question had a 3 mark section about this. You were told about ancient writings on goatskins which had become broken into fragments, with the implication that the fragments might have come from several different goatskins.

You were then asked how DNA fingerprinting might be used to identify which fragment came from which skin.

Before we look at that, my gut feeling is that you are more likely to be asked a question like this than a question asking you to just quote an example of the use of DNA testing in archeology. For one thing, a question which gives you a context, and asks you to comment on it, is far easier to mark!

Anyway . . .

All they wanted was for you to suggest that you compared the DNA fingerprints of every fragment, and then matched them to find out which came from the same skins. That was worth 2 marks, and is something that you could fairly easily work out even if you hadn't come across the problem before.

DNA fingerprints and medicine

The Chemistry Applications Support Booklet mentions using DNA fingerprinting in tuberculosis (TB) and cancers to see whether the problem is a recurrence of an old disease or is due to a new one.

The Chemistry Coursebook has quite a long section about genetic testing (which is much easier to discuss), but I am not convinced that this is the same as DNA fingerprinting. CIE haven't set any questions so far (in the 13 exam sessions up to June 2013) which asked for this. It needs a comment from an Examiner's Report to find out what they will or won't accept.

I will come back to this if a question comes up in the future. In the meantime, you would probably be safer to stick to what the Support Booklet is saying - they would have to accept that.

A simple question asking you for a medical use won't be worth more than 1 mark. Any more complicated question would give you all the background information you need, and then ask you to apply what you already know about DNA fingerprinting to that. So there shouldn't be a problem.

Go to the Section 11.2 Menu . . .

To return to the list of learning outcomes in Section 11.2

Go to the CIE Main Menu . . .

To return to the list of all the CIE sections

Go to Chemguide Main Menu . . .

This will take you to the main part of Chemguide.